View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3112_low_18 (Length: 254)
Name: NF3112_low_18
Description: NF3112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3112_low_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 130; Significance: 2e-67; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 26 - 159
Target Start/End: Complemental strand, 27897723 - 27897590
Alignment:
| Q |
26 |
cttctcaggttgtatcttagcatcaaccattgttatgataggaactattaaggttaatgccaatgaaaattctcttgacaatatattaacgctggatttt |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27897723 |
cttctcaggttgtatcttagcatcaaccattgttatgataggaactattaaggttaatggcaatgaaaattctcttgacaatatattaacgctggatttt |
27897624 |
T |
|
| Q |
126 |
gtggtttactcaagaaccataattacaaatgaat |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
27897623 |
gtggtttactcaagaaccataattacaaatgaat |
27897590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 159 - 237
Target Start/End: Complemental strand, 27892644 - 27892566
Alignment:
| Q |
159 |
tttaaggtttttcaaaatcatgtgacgtcacttctatcttaatagatgatgtgcttgcaattttgaatggtctagatat |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
27892644 |
tttaaggtttttcaaaatcatgtgacgtcacttctatcttaatagatgatgtacttgcaattttgaatggtctagatat |
27892566 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 50 - 183
Target Start/End: Complemental strand, 27891973 - 27891841
Alignment:
| Q |
50 |
aaccattgttatgataggaactattaaggttaatgccaatgaaaattctcttgacaatatattaacgctggattttgtggtttactcaagaaccataatt |
149 |
Q |
| |
|
||||| |||||||||||||| |||||||| |||||||||||||| ||||||||| |||||||| | |||| ||||||||||||||||| |||||||||| |
|
|
| T |
27891973 |
aaccactgttatgataggaattattaaggctaatgccaatgaaagttctcttgataatatattcatgctgaattttgtggtttactcaggaaccataatg |
27891874 |
T |
|
| Q |
150 |
acaaatgaatttaaggtttttcaaaatcatgtga |
183 |
Q |
| |
|
| ||||||||| ||||||||| ||||||||| |
|
|
| T |
27891873 |
a-tgatgaatttatagtttttcaatatcatgtga |
27891841 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University