View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3112_low_19 (Length: 250)
Name: NF3112_low_19
Description: NF3112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3112_low_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 40313625 - 40313394
Alignment:
| Q |
1 |
cgacccacttagagtcatcccacaacgttgcttaaaaaccacactattagctttatcaacaagattataatttatgataagattcaagacatgatgagca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
40313625 |
cgacccacttagagtcatcccacaacgttgcttaaaaaccacactattagctttatcaacaagattataatttatgataagattcaagacatggagagca |
40313526 |
T |
 |
| Q |
101 |
agattataacttcattccaccatgaggagaatgcacctacttagcttagtttatagagataacttgtgtaacaagttatcaagttagtttgttctttgta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| | |
|
|
| T |
40313525 |
agattataacttcattccaccatgaggagaatgcacctacttagcttagtttatagagataacttgtgtaacaagttatcaagttactttgttctttgca |
40313426 |
T |
 |
| Q |
201 |
ttctatggttgatgcctcaccatagttatcat |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
40313425 |
ttctatggttgatgcctcaccatagttatcat |
40313394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 124 - 189
Target Start/End: Complemental strand, 736414 - 736349
Alignment:
| Q |
124 |
gaggagaatgcacctacttagcttagtttatagagataacttgtgtaacaagttatcaagttagtt |
189 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |||||||||||| ||| |||||||| |||||||| |
|
|
| T |
736414 |
gaggagaatgcaactacttagcttagtttacggagataacttgtataataagttatcgagttagtt |
736349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 152 - 189
Target Start/End: Complemental strand, 38644592 - 38644555
Alignment:
| Q |
152 |
tatagagataacttgtgtaacaagttatcaagttagtt |
189 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
38644592 |
tatagagataacttgtgtaacaagttatccaattagtt |
38644555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University