View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3112_low_23 (Length: 227)
Name: NF3112_low_23
Description: NF3112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3112_low_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 20 - 210
Target Start/End: Original strand, 39784315 - 39784513
Alignment:
| Q |
20 |
agagagaataagaatataatggaacacgtagagtaaatgtagataaaaatttgatgtgatttgtaagtagatttataaacactctt--------gaagtc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
39784315 |
agagagaataagaatataatggaacacgtagagtaaatgtagataaaaatttgatgtgatttgtaaatagatttataaacactctttgaattttgaagtc |
39784414 |
T |
 |
| Q |
112 |
tatccccattctagtaaatttccagagtccgtctcaaataaacttttatgctataaaaaatgtatataaaaaagttcataagtgatcagttgctcaaac |
210 |
Q |
| |
|
||| ||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
39784415 |
tattcccattccagtaaatttctagagtccgtctcaaataaacttttatgctataaaaaatgtatataaaaaagttcataagtgatcggttgctcaaac |
39784513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University