View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3112_low_4 (Length: 523)
Name: NF3112_low_4
Description: NF3112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3112_low_4 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 494; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 494; E-Value: 0
Query Start/End: Original strand, 18 - 523
Target Start/End: Complemental strand, 34899403 - 34898898
Alignment:
| Q |
18 |
gatttgtctcattatcagccattgcaagaatttattggcagcggtggcggaactggagtctttaaggctcctattagaatggccgttcatcctgggagac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899403 |
gatttgtctcattatcagccattgcaagaatttattggcagcggtggcggaactggagtctttaaggctcctattagaatggccgttcatcctgggagac |
34899304 |
T |
|
| Q |
118 |
cgccatgtcttgagttaaggcctcatccgttaagggagactcaggtagggaaattcctcagaaacattgcatgtaccgaaacacagttgtgggctggaca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
34899303 |
cgccatgtcttgagttaaggcctcatccgttaagggagactcaggtagggaaattcctcagaaacattgcatgtaccgaaacacagctgtgggctggaca |
34899204 |
T |
|
| Q |
218 |
ggaaagtggggtgagggtgtgggagtttcaaaaggcctatgaacacggttgcggtctgggaggaagggttaggaggggagatgaggacgctgcgcctttt |
317 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
34899203 |
ggaatgtggggtgagggtgtgggagtttcaaaaggcctatgaacacggttgcggtctgggaggaagggttaggaggggagatgaggacgctgcacctttt |
34899104 |
T |
|
| Q |
318 |
tatgaatctgctgatacctctcctacattttgtttgaccgtcgacaacgggaataagatggtctggactggccataaggatggcaagattaggtcatgga |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899103 |
tatgaatctgctgatacctctcctacattttgtttgaccgtcgacaacgggaataagatggtctggactggccataaggatggcaagattaggtcatgga |
34899004 |
T |
|
| Q |
418 |
aagtggatcaacaattttcgaccccctttaaggaaggtctttcttggcaggcacacagaggtcccgttcttgccatgatcataagcagctacggtaggcc |
517 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899003 |
aagtggatcaacaattttcgaccccctttaaggaaggtctttcttggcaggcacacagaggtcccgttcttgccatgatcataagcagctacggtaggcc |
34898904 |
T |
|
| Q |
518 |
tctccc |
523 |
Q |
| |
|
|||||| |
|
|
| T |
34898903 |
tctccc |
34898898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University