View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3112_low_9 (Length: 377)
Name: NF3112_low_9
Description: NF3112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3112_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 130; Significance: 3e-67; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 130; E-Value: 3e-67
Query Start/End: Original strand, 1 - 130
Target Start/End: Original strand, 2451224 - 2451353
Alignment:
| Q |
1 |
atagttacaacagtttcacctcgaaacccaaattcattgttcatatcttttctcctaatttccttcttctgtttcacaccactacttgctaaatctcctc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2451224 |
atagttacaacagtttcacctcgaaacccaaattcattgttcatatcttttctcctaatttccttcttctgtttcacaccactacttgctaaatctcctc |
2451323 |
T |
 |
| Q |
101 |
acccaatctctgtatgtctccctcacaaca |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
2451324 |
acccaatctctgtatgtctccctcacaaca |
2451353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 199 - 320
Target Start/End: Original strand, 2451423 - 2451544
Alignment:
| Q |
199 |
gcaggatgttcaagttaggaataacaagattcaatgttatgctgatattgacaggttttcttcattctccactttttcctcttattataagnnnnnnngt |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
2451423 |
gcaggatgttcaagttaggaataacaagattcagtgttatgctgatattgacaggttttcttcattctccactttttcctcttattataagtttttttgt |
2451522 |
T |
 |
| Q |
299 |
gttaattttcacaaaaataagt |
320 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
2451523 |
gttaattttcacaaaaataagt |
2451544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 324 - 356
Target Start/End: Original strand, 2451581 - 2451613
Alignment:
| Q |
324 |
tttgaaagaatgtgacaatttttgggacaatgg |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
2451581 |
tttgaaagaatgtgacaatttttgggacaatgg |
2451613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University