View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3114_high_104 (Length: 227)
Name: NF3114_high_104
Description: NF3114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3114_high_104 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 5 - 227
Target Start/End: Original strand, 46484425 - 46484648
Alignment:
| Q |
5 |
caatatgcacactcaccgccaagtaccgtcaagaaatgcttgctgggagtaataaatttttcacaaaaacaagtaagtgaagcatcttaaattctcaatc |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46484425 |
caatatgcacactcaccgccaagtaccgtcaagaaatgcttgctgggagtaataaatttttcacaaaaacaagtaagtgaagcatcttaaattctcaatc |
46484524 |
T |
 |
| Q |
105 |
gtgggagtattttctatcataaggttatgtgtatgtcatgcaagggatgtgatgtagtactataaaagacaggttatgtcggacggaagtctctcactc- |
203 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46484525 |
gtgggagaattttctatcataaggttatgtgtatgtcatgcaagggatgtgatgtagtactataaaagacaggttatgtcggacggaagtctctcactca |
46484624 |
T |
 |
| Q |
204 |
tccctaaaattagatccatccctt |
227 |
Q |
| |
|
|| ||||||||||||||||||||| |
|
|
| T |
46484625 |
tctctaaaattagatccatccctt |
46484648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University