View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3114_high_105 (Length: 227)
Name: NF3114_high_105
Description: NF3114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3114_high_105 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 7 - 227
Target Start/End: Original strand, 3844759 - 3844979
Alignment:
| Q |
7 |
aaaatgagataatggcattaattttgcattccaacaacgtatctttcatggtcagttttgccaataagaatggacaatgatatttattcgccaaccagat |
106 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3844759 |
aaaacgagataatggcattaattttgcattccaacaacgtatctttcatggtcagttttgccaataagaatggacaacgatatttattcgccaaccagat |
3844858 |
T |
 |
| Q |
107 |
tacagtgacaccaggttttgtattttctcttgaaatgggatttgatttctgacagacaaaaacaaaatctcccttgtggttccacatacacagggatatt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3844859 |
tacagtgacaccaggttttgtattttctattgaaatgggatttgatttctgacagacaaaaacaaaatctccgttgtggttccacatacacagggatatt |
3844958 |
T |
 |
| Q |
207 |
gatgctgctttttctaaggat |
227 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
3844959 |
gatgctgctttttctaaggat |
3844979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University