View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3114_high_112 (Length: 211)

Name: NF3114_high_112
Description: NF3114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3114_high_112
NF3114_high_112
[»] chr2 (1 HSPs)
chr2 (19-197)||(43375127-43375305)


Alignment Details
Target: chr2 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 19 - 197
Target Start/End: Complemental strand, 43375305 - 43375127
Alignment:
19 cttacactggttggaaagatgagagaaacgatcctgttaaggcagtgacatttggggatggcagccctttacctgctgatgtagtgtacaattgtcttaa 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
43375305 cttacactggttggaaagatgagagaaacgatcctgttaaggcagtgacatttggggatggcagccctttacctgctgatgtagtgtacgattgtcttaa 43375206  T
119 catacttgaggaggaatctgttgctattccttggcgtaaaggcgatgttatgttgctcgataattgggctgttcttcat 197  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43375205 catacttgaggaggaatctgttgctattccttggcgtaaaggcgatgttatgttgctcgataattgggctgttcttcat 43375127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University