View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3114_high_45 (Length: 325)
Name: NF3114_high_45
Description: NF3114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3114_high_45 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 19 - 315
Target Start/End: Complemental strand, 32135253 - 32134954
Alignment:
| Q |
19 |
tcattcttctttcttacaaccaaagtatcctcctaaaacgatgtcgtttccgtgtgactattgcgacacaagaagcgcggtgctatattgcaaaccagac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32135253 |
tcattcttctttcttacaaccaaagtatcctcctaaaacgatgtcgtttccgtgtgactattgcgacacaagaagcgcggtgctatattgcaaaccagac |
32135154 |
T |
 |
| Q |
119 |
tccgcgaaactctgtttagtttgcgaccagcacgtgcactccgcaaacgcactcgcactcaagcacgtgcgtttccaaatctgtcaaaactgcaaaaacg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32135153 |
tccgcgaaactctgtttagtttgcgaccagcacgtgcactccgcaaacgcactcgcactcaagcacgtgcgtttccaaatctgtcaaaactgcaaaaacg |
32135054 |
T |
 |
| Q |
219 |
acgccgcttcagttcgttgcttcaccgaaaacctagttcaatgtcaccgctgcgattggaactctcacggcggcgacga---cgactccacctcttcatc |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
32135053 |
acgccgcttcagttcgttgcttcaccgaaaacctagttcaatgtcaccgctgcgattggaactctcacggcggcgacgacgacgactccacctcttcatc |
32134954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University