View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3114_high_49 (Length: 313)
Name: NF3114_high_49
Description: NF3114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3114_high_49 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 18 - 301
Target Start/End: Original strand, 48660000 - 48660283
Alignment:
| Q |
18 |
atagggatgattcttgaaataattataatgttccctgtggagcaccgttcatacagggatggaatcaacaaccttcttgttctcctgattggaggaattc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48660000 |
atagggatgattcttgaaataattataatgttccctgtggagcaccgttcatacagggatggaatcaacaaccttcttgttctcctgattggaggaattc |
48660099 |
T |
|
| Q |
118 |
ccatagctatgccaacagtattatctgtaacacttgccattggatcccatcgcctttctcagcaggtttgcaagtttttatctattagctttaagtagta |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48660100 |
ccatagctatgccaacagtattatctgtaacacttgccattggatcccatcgcctttctcagcaggtttgcaagtttttatctattagctttaagtagta |
48660199 |
T |
|
| Q |
218 |
tagtccgtatcaaattccctagttatgttcgtttggcactaagattcaaacaaatggggtgaagttaatttaagcttttgtctg |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48660200 |
tagtccgtatcaaattccctagttatgttcgtttggcactaaaattcaaacaaatggggtgaagttaatttaagcttttgtctg |
48660283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University