View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3114_high_50 (Length: 308)
Name: NF3114_high_50
Description: NF3114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3114_high_50 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 57 - 296
Target Start/End: Original strand, 43010553 - 43010785
Alignment:
| Q |
57 |
acaatgcttgtcgtttgtaaggaagcaccacgagaagtgaagtataagcttgttgtaagatgaatactttctctttatatagccttagtaacagggccgt |
156 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43010553 |
acaatgcttgtcgtttgtaaggaagtaccacgagaagtgaagtataagcttgttgtaagatgaatactttctctttatatagccttagtaacagggccgt |
43010652 |
T |
 |
| Q |
157 |
tggtaacaaaacataccaactatcacaacttatcacattaaagcttgggtatgaaaataagtaatgagggattgtgcaaaggttttgcaaacatcagcgt |
256 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43010653 |
tggtaacaaaacatac---------caacttatcacattaaagcttgggtatgaaaataaggaatgagggattgtgcaaaggttttgcaaacatcagcgt |
43010743 |
T |
 |
| Q |
257 |
t--gcagcagaagtatgcgaaatagtttgaatattgtctctg |
296 |
Q |
| |
|
| ||| ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
43010744 |
tgcgcaacagaagtatgcgaaatagtttgaatatcgtctctg |
43010785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University