View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3114_high_60 (Length: 277)
Name: NF3114_high_60
Description: NF3114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3114_high_60 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 7 - 265
Target Start/End: Complemental strand, 35302256 - 35301998
Alignment:
| Q |
7 |
aggtttcaattctgtatggtgttagtggaaaattgtttgttcttaattttgtgaagaaatgtattctggttggtgcttcggctctgcttttgtttccgtt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35302256 |
aggtttcaattctgtatggtgttagtggaaaattgtttgttcttaattttgtgaagaaatgtattctggttggtgcttcggctctgcttttgtttccgtt |
35302157 |
T |
 |
| Q |
107 |
agggaacgagggtggtgagtctgttggttcgaaggaaggaaagagtgacaccaattgtattaaggagaggaaaattttgatgccgcaggttgttgctgct |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
35302156 |
agggaacgagggtggtgagtctgttggttcgaaggaaggaaagagtgacaccaattgtattagggagaggaaaattttgatgccgcaagttgttgctgct |
35302057 |
T |
 |
| Q |
207 |
gttgcggcgttgcacgaacgagctttgcttgaacgtaaaattaaggaattttggttttc |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35302056 |
gttgcggcgttgcacgaacgagctttgcttgaacgtaaaattaaggaattttggttttc |
35301998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University