View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3114_high_68 (Length: 256)
Name: NF3114_high_68
Description: NF3114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3114_high_68 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 22 - 246
Target Start/End: Complemental strand, 34261754 - 34261530
Alignment:
| Q |
22 |
caaactttgtcaaacaatattttattctccggaatctctcttactatactatttttattcattttgtttattttaatccttaagtaaatannnnnnnnat |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| || |
|
|
| T |
34261754 |
caaactttgtcaaacaatattttattctccggaatctctcttactatactatttttattcattttgtttattttaatccttaagttaatattttttttat |
34261655 |
T |
 |
| Q |
122 |
aataatgttaaatcaaatgtcaatggaaacagactagctaccacatggtttgctttgctctatataggagagaagaaaacttgttgcttcagttggatta |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34261654 |
aataatgttaaatcaaatgtcaatggaaacagaatagctaccacatggtttgctttgctctatataggagagaagaaaacttgttgcttcagttggatta |
34261555 |
T |
 |
| Q |
222 |
ctcactcattggattgctctctctg |
246 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
34261554 |
ctcactcattggattgctctctctg |
34261530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University