View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3114_high_71 (Length: 251)
Name: NF3114_high_71
Description: NF3114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3114_high_71 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 14 - 213
Target Start/End: Complemental strand, 40057227 - 40057038
Alignment:
| Q |
14 |
aggtggtatagataaatatattcagaattactgacagattcaaaccccggccaccacnnnnnnnnnnnnnntactaacaaatgataaatattttgtttgg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
40057227 |
aggtggtatagataaatatattcagaattactgatagattcaaaccccggccaccacaaaaaaaat-----tactaacaaatgataaatattttgtttgg |
40057133 |
T |
|
| Q |
114 |
gcttgaactgtgctacgtaatgtggtcaataggttgaaaaattactctttacgctttcattttttctccaaatcatctgaaaagaccaaaacacctcaaa |
213 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40057132 |
gcttgaactgtgctacgt-----ggtcaataggttgaaaaattactctttacgctctcattttttctccaaatcatctgaaaagaccaaaacacctcaaa |
40057038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University