View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3114_high_74 (Length: 251)
Name: NF3114_high_74
Description: NF3114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3114_high_74 |
 | |
|
| [»] scaffold0024 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0024 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 30649 - 30427
Alignment:
| Q |
1 |
actagtcataactattattagtagaaaaacactaatgactattttacagccgaccctgagagaactttgtcgttaaactcttatcac--taagctaacac |
98 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||| || | | |||| || ||||||||||| |
|
|
| T |
30649 |
actagtcataactattattagtaaaaaaacactaatgactattttacaatcgaccctgagagaactttatctcttgagg-ttatgacgttaagctaacac |
30551 |
T |
|
| Q |
99 |
ctttatggcgttatgtaattcaatggaagctaattagagatgataagataagaaaaaattacataattagaaagcgctatttgtgaaggcgaaaccattt |
198 |
Q |
| |
|
||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
30550 |
ctt-atggcattatgtaattcaatggaagctaattagagatgataagataagaaaaaagtacataattagaaagcgctatttgtgaaggtgaaatcattt |
30452 |
T |
|
| Q |
199 |
ccactatcaaagtgactattgtttc |
223 |
Q |
| |
|
||||||| ||||||||| ||||||| |
|
|
| T |
30451 |
ccactatgaaagtgactgttgtttc |
30427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 176 - 245
Target Start/End: Complemental strand, 65704 - 65635
Alignment:
| Q |
176 |
tatttgtgaaggcgaaaccatttccactatcaaagtgactattgtttcataaccatgatacctatgctac |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
65704 |
tatttgtgaaggcgaaaccatttccactatcaaagtgactattgtttcataaccatgatacctatgctac |
65635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University