View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3114_high_81 (Length: 249)

Name: NF3114_high_81
Description: NF3114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3114_high_81
NF3114_high_81
[»] chr8 (2 HSPs)
chr8 (125-198)||(4608379-4608452)
chr8 (12-61)||(4608266-4608315)


Alignment Details
Target: chr8 (Bit Score: 74; Significance: 5e-34; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 125 - 198
Target Start/End: Original strand, 4608379 - 4608452
Alignment:
125 gagcctctctctgataactttctgtgacatctttttgtcatgtaatacagttcttcacgagctagtgtcagaag 198  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4608379 gagcctctctctgataactttctgtgacatctttttgtcatgtaatacagttcttcacgagctagtgtcagaag 4608452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 12 - 61
Target Start/End: Original strand, 4608266 - 4608315
Alignment:
12 atgaaggtgttttagattttgaagttttatgcaagtaatattctaatggg 61  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
4608266 atgaaggtgttttagattttgaagttttatgcaagtaatattctaatggg 4608315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University