View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3114_high_81 (Length: 249)
Name: NF3114_high_81
Description: NF3114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3114_high_81 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 74; Significance: 5e-34; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 125 - 198
Target Start/End: Original strand, 4608379 - 4608452
Alignment:
| Q |
125 |
gagcctctctctgataactttctgtgacatctttttgtcatgtaatacagttcttcacgagctagtgtcagaag |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4608379 |
gagcctctctctgataactttctgtgacatctttttgtcatgtaatacagttcttcacgagctagtgtcagaag |
4608452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 12 - 61
Target Start/End: Original strand, 4608266 - 4608315
Alignment:
| Q |
12 |
atgaaggtgttttagattttgaagttttatgcaagtaatattctaatggg |
61 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4608266 |
atgaaggtgttttagattttgaagttttatgcaagtaatattctaatggg |
4608315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University