View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3114_high_97 (Length: 237)
Name: NF3114_high_97
Description: NF3114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3114_high_97 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 89 - 221
Target Start/End: Original strand, 865376 - 865508
Alignment:
| Q |
89 |
ttttaaattgaccttgcatcaaaattaatctcttaaaactataagattctctcatttgtgattttgacatttttgttatatgtaggcactaaggttctat |
188 |
Q |
| |
|
|||||||||||| |||| |||||||||||||| ||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
865376 |
ttttaaattgactttgcgtcaaaattaatctcataaaactataagattctatcatatgtgattttgacatttttgttatatgtaggcactaaggttctat |
865475 |
T |
|
| Q |
189 |
ggaagtgatggtgtaagtgtgagtggtataacc |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
865476 |
ggaagtgatggtgtaagtgtgagtggtataacc |
865508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 40 - 121
Target Start/End: Original strand, 36655261 - 36655340
Alignment:
| Q |
40 |
taaaagtcatacaaatgattatatacaattgattgagtgagtgtaaattttttaaattgaccttgcatcaaaattaatctct |
121 |
Q |
| |
|
||||||||||||||||||| || || ||||| ||| ||||| ||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
36655261 |
taaaagtcatacaaatgatgatttataattggctgac--agtgtcaattttttacattgacactgcatcaaaattaatctct |
36655340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University