View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3114_low_113 (Length: 224)
Name: NF3114_low_113
Description: NF3114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3114_low_113 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 15 - 165
Target Start/End: Original strand, 10847331 - 10847481
Alignment:
| Q |
15 |
aatataatggttataattataagtacaataaattattttaaattgtccaatttgtgattggttagaaccttatctgatccattggtgtgcattgttctaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
10847331 |
aatataatggttataattataagtacaataaattattttaaattgtccaatttgtgattggttagaaccttatctgatccattgatgtgcattgttctaa |
10847430 |
T |
|
| Q |
115 |
taatatcgatgatgctatccaaatttcaactcataataattttttattatt |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10847431 |
taatatcgatgatgctatccaaatttcaactcataataattttttattatt |
10847481 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University