View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3114_low_115 (Length: 220)
Name: NF3114_low_115
Description: NF3114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3114_low_115 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 122; Significance: 9e-63; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 13 - 197
Target Start/End: Original strand, 34630383 - 34630562
Alignment:
| Q |
13 |
atgaaccaaaactgggcaataaatttcatcgtaaattgtgtaattaat-gatagcttatttgcaaaataaatatagttttattgagattaattgctatgc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34630383 |
atgaaccaaaactgggcaataaatttcatcgtaaattgtgtaattaatagatagcttatttgcaaaataaatatagttttattgagattaattgctatgc |
34630482 |
T |
 |
| Q |
112 |
accaacatgatgtattttcnnnnnnnnnnnnnacgttgagtgacctagacgttatatatcgaaattttaggttgtgtgacctagac |
197 |
Q |
| |
|
||| ||||||||||||||| |||||| |||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
34630483 |
accgacatgatgtattttc------tttttttacgttgcgtgacctagacgttatgtatcgaaattttaggttgtgtgacctagac |
34630562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University