View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3114_low_119 (Length: 211)
Name: NF3114_low_119
Description: NF3114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3114_low_119 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 19 - 197
Target Start/End: Complemental strand, 43375305 - 43375127
Alignment:
| Q |
19 |
cttacactggttggaaagatgagagaaacgatcctgttaaggcagtgacatttggggatggcagccctttacctgctgatgtagtgtacaattgtcttaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
43375305 |
cttacactggttggaaagatgagagaaacgatcctgttaaggcagtgacatttggggatggcagccctttacctgctgatgtagtgtacgattgtcttaa |
43375206 |
T |
 |
| Q |
119 |
catacttgaggaggaatctgttgctattccttggcgtaaaggcgatgttatgttgctcgataattgggctgttcttcat |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43375205 |
catacttgaggaggaatctgttgctattccttggcgtaaaggcgatgttatgttgctcgataattgggctgttcttcat |
43375127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University