View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3114_low_27 (Length: 425)
Name: NF3114_low_27
Description: NF3114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3114_low_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 379; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 379; E-Value: 0
Query Start/End: Original strand, 18 - 416
Target Start/End: Original strand, 41484812 - 41485210
Alignment:
| Q |
18 |
caatacgtagtgcagactacttcaatgagcgattcaagctcatatatgggtctgaaaaggatcttaaatggtccctttagtatatgatcaccgaaggaat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
41484812 |
caatacgtagtgcagactacttcaatgagcgattcaagctcatatatgggtctgaaaaggatcttaaatggtccctttagtctatgatcaccgaaggaat |
41484911 |
T |
|
| Q |
118 |
gcactttctttctgaaatctatatccaagggaaaatgggtgatccctgacgattttggggaagaggaagaaggttctgaagaggcagatgtcgaagagga |
217 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41484912 |
gcactttctttctgaaatctatatccgagggaaaatgggtgatccctgacgattttggggaagaggaagaaggttctgaagaggcagatgtcgaagagga |
41485011 |
T |
|
| Q |
218 |
tgcatgcttatcttgcttttagtctcttgtattttggggaaataatgctagaatattttcagccctttcggttcgtttttaaatatacagtaatctttct |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
41485012 |
tgcatgcttatcttgcttttagtctcttgtattttggggaaataatgttagaatattttcagccctttcggttcgcttttaaatatacagtaatctttct |
41485111 |
T |
|
| Q |
318 |
caaatatctttgtgtttaacatcctttgcgtgaatattttcttttcgttgttttgtttaatgttttgtcaagagtagtgattccatacaatgatgatgt |
416 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41485112 |
cgaatatctttgtgtttaacatcctttgcgtgaatattttcttttcgttgttttgtttaatgttttgtcaagagtagtgattccatacaatgatgatgt |
41485210 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University