View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3114_low_53 (Length: 316)
Name: NF3114_low_53
Description: NF3114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3114_low_53 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 13 - 300
Target Start/End: Complemental strand, 7737381 - 7737103
Alignment:
| Q |
13 |
aatatagtttgtgtctagaaattaatgacaaacaagcacacaaaaacaaagaaatgaaggtgtgtttcagttaatcgttgtaggacacacattttcttag |
112 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7737381 |
aatatagtttgtgtctataaattaatgacaaacaagcacacagaaacaaagaaatgaaggtgtgtttcagttaatcgttgtaggacacacattttcttag |
7737282 |
T |
 |
| Q |
113 |
gcaggaatggttggggaacaaggttgaattatgcattaattaataactcaagttccttgaacctttttcaatttttgttgtaatttttaagcaaggaata |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7737281 |
gcaggaatggttggggaacaaggttgaattatgcattaattaataactcaagttccttgaacc-ttttcaatttttgttgtaattattaagcaaggaata |
7737183 |
T |
 |
| Q |
213 |
ttgtacgaacaagttaccacttgaataatggttatattttactattttactaagatatcataatactggttatgaatatgcaatcttg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7737182 |
ttgtacgaacaagttaccacttgaataatggtta--------tattttactaagatatcataatattggttatgaatatgcaatcttg |
7737103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University