View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3114_low_67 (Length: 275)
Name: NF3114_low_67
Description: NF3114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3114_low_67 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 17 - 265
Target Start/End: Original strand, 17149702 - 17149951
Alignment:
| Q |
17 |
aaaatgtaacatcatgtaattactataatttttattgatggatttaggggggtcaaagttcaaaatagctttaaagagtgagaaatgcaaaaaggaaggt |
116 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17149702 |
aaaatgtaacatcatgtgattactataatttttattgatggatttaggggggtcaaagttcaaaatagctttaaagagtgagaaatgcaaaaaggaaggt |
17149801 |
T |
 |
| Q |
117 |
aggagctactaggttaggaactaggacggttgagagtggaaatgaaaaggggtgaaaatgtttttgatttttacttgttagtgcttgctagagaaaaagc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17149802 |
aggagctactaggttaggaactaggacggttgagagtggaaatgaaaaggggtgaaaatgtttttgatttttacttgttagtgcttgctagagaaaaagc |
17149901 |
T |
 |
| Q |
217 |
tgaaagtaaaataattgaacat-ggttggttttgttggtttggatctgtg |
265 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
17149902 |
tgaaagtaaaataattgaacatcggttggttttgttggtttggatttgtg |
17149951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University