View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3114_low_71 (Length: 263)
Name: NF3114_low_71
Description: NF3114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3114_low_71 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 13 - 247
Target Start/End: Complemental strand, 9692281 - 9692047
Alignment:
| Q |
13 |
aagggtcacatatacaaccatatacaaatgtgataatttttcagtaagtcttgcaatctcttattttaatcgtttgtcaccaatgcaattactagctaga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9692281 |
aagggtcacatatacaaccatatacaaatgtgataatttttcagtaagtcttgcaatctcttattttaatcgtttgtcaccaatgcaattactagctaga |
9692182 |
T |
|
| Q |
113 |
atatatatgtaattaatttaagtgtannnnnnngtacatgcagctatgtannnnnnncctaccttcaaaaggagtcattcctcttcataaccacccagga |
212 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9692181 |
atatatatgtaattaatttaagtgtatttttttgtacatgcagctatgtatttttttcctaccttcaaaaggagtcattcctcttcataaccacccagga |
9692082 |
T |
|
| Q |
213 |
atgactgttttcagtaagcttttgttgggacaaat |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
9692081 |
atgactgttttcagtaagcttttgttgggacaaat |
9692047 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 182 - 226
Target Start/End: Original strand, 33528418 - 33528462
Alignment:
| Q |
182 |
aggagtcattcctcttcataaccacccaggaatgactgttttcag |
226 |
Q |
| |
|
|||||||||||| || |||||||||||||| |||||||||||||| |
|
|
| T |
33528418 |
aggagtcattcccctccataaccacccaggcatgactgttttcag |
33528462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University