View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3114_low_75 (Length: 255)
Name: NF3114_low_75
Description: NF3114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3114_low_75 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 18 - 255
Target Start/End: Original strand, 8342366 - 8342605
Alignment:
| Q |
18 |
agagggtgtgtctaatatgattggcctcggagttg--tgcctccaaaacgacaggagacggcacatccaccaccgttggaggtggaggcaacaacagtat |
115 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
8342366 |
agagggtgtgtctgatatgattggcctcggagtggcatgcctccaaaacgacaggagacggcacatccaccaccattggaggtggaggcaacaacagtat |
8342465 |
T |
|
| Q |
116 |
ccactgcgtttctattaaaaagacaacatggttaaactaggccttttggaaacgttccatttatgagtcgttcgtgagatttgtatgacacctatgtcgt |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8342466 |
ccactgcgtttctattaaaaagacaacatggttaagctaggccatttggaaacgttccatttatgagtcgttcgtgagatttgtatgacacctatgtcgt |
8342565 |
T |
|
| Q |
216 |
gcacattagcatttctctgttgcaaattaaattggagatt |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
8342566 |
gcacattagcatttctctgttgcaaattaacttggagatt |
8342605 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 22 - 90
Target Start/End: Complemental strand, 3228180 - 3228110
Alignment:
| Q |
22 |
ggtgtgtctaatatgattggcctcggagttg--tgcctccaaaacgacaggagacggcacatccaccaccg |
90 |
Q |
| |
|
||||| ||| ||||||||||||||||||| | ||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
3228180 |
ggtgtttctgatatgattggcctcggagtggcatgcctccaaaatgacaggagtcggcacatccaccaccg |
3228110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University