View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3114_low_87 (Length: 250)

Name: NF3114_low_87
Description: NF3114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3114_low_87
NF3114_low_87
[»] chr4 (1 HSPs)
chr4 (12-108)||(46484656-46484747)


Alignment Details
Target: chr4 (Bit Score: 69; Significance: 5e-31; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 12 - 108
Target Start/End: Original strand, 46484656 - 46484747
Alignment:
12 tagcaataatgaggtaaaagttcaataaatacggaaatatttaaagataaagattagattgatctcaaaataagtcaccaaatagtaatgcatacac 108  Q
    ||||||||||| |||| ||||||||     |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46484656 tagcaataatgtggtacaagttcaa-----acggaaatatttaaagataaagattagattgatctcaaaataagtcaccaaatagtaatgcatacac 46484747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University