View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3114_low_89 (Length: 248)
Name: NF3114_low_89
Description: NF3114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3114_low_89 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 92; Significance: 8e-45; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 103 - 238
Target Start/End: Complemental strand, 865036 - 864901
Alignment:
| Q |
103 |
tgcatataaattaaatcatattttaatgataaagaagttcaatgaaatgattattcttaccgttggtttggtttttggtagtttctcactatcattccac |
202 |
Q |
| |
|
|||||||||| | |||||||||||||||| | |||| | ||||| | || ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
865036 |
tgcatataaaatgaatcatattttaatgacatagaaatccaatgctaggactattcttaccgttggtttggtttttggtagtttctcactatcattccac |
864937 |
T |
|
| Q |
203 |
caaacagatccttgaccatcaatgacacctttgcct |
238 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| |
|
|
| T |
864936 |
caaacagagccttgaccatcaatgacacctttgcct |
864901 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University