View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3114_low_91 (Length: 247)
Name: NF3114_low_91
Description: NF3114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3114_low_91 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 1 - 101
Target Start/End: Original strand, 15262947 - 15263047
Alignment:
| Q |
1 |
tcataaccggcatgacaggtgaatctgtcacggccgctgcaggtaattacaaccacacgcagaatactgctggtggtggtaataacagtaacggccgtga |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15262947 |
tcataaccggcatgacaggtgagtctgtcacggccgctgcaggtaattaccaccacacgcaaaatactgctggtggtggtaataacagtaacggccgtga |
15263046 |
T |
|
| Q |
101 |
c |
101 |
Q |
| |
|
| |
|
|
| T |
15263047 |
c |
15263047 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 165 - 230
Target Start/End: Original strand, 15263102 - 15263167
Alignment:
| Q |
165 |
aatttggtaagaaattttgatggtggaattgggagcaactacgatgctagtctcttggctatgaat |
230 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
15263102 |
aatttggttagaaattttgatggtggaattgggagcaactatgatgctagtctcttggctatgaat |
15263167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University