View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3115R-Insertion-7 (Length: 205)
Name: NF3115R-Insertion-7
Description: NF3115R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3115R-Insertion-7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 161; Significance: 5e-86; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 9 - 197
Target Start/End: Complemental strand, 18790650 - 18790462
Alignment:
| Q |
9 |
cacaaaactaacgaaatactataatgaaccctaatatcattctcagcttcaggaatttggtcttatatataaaggcttatatatacaacactttacataa |
108 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| ||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18790650 |
cacaaaactaatgaaatactataatgaaccctaatatctttctcagcttcaggagtctggtcttatatataaaggcttatatatacaacactttacataa |
18790551 |
T |
|
| Q |
109 |
gaaataagaacactttaatcaaaaccataagaaacttggtaaagaatatataattgttatcaaatggcaaaccacttctcaatcttgtt |
197 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
18790550 |
gaaataagaacactttaatcaaaaccaaaagaaacttgataaagaatatataattgttatcaaatggcaaaccacttctcaaacttgtt |
18790462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 160 - 193
Target Start/End: Complemental strand, 18781847 - 18781814
Alignment:
| Q |
160 |
aattgttatcaaatggcaaaccacttctcaatct |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
18781847 |
aattgttatcaaatggcaaaccacttctcaatct |
18781814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University