View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3115_high_32 (Length: 262)
Name: NF3115_high_32
Description: NF3115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3115_high_32 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 76 - 198
Target Start/End: Complemental strand, 29740598 - 29740476
Alignment:
| Q |
76 |
aaaccagtaattcctgtaagattcaaagccccattaagctgatattcaaataatacttgattgaactatgtagatgatttatataagatcttaaaccaaa |
175 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
29740598 |
aaaccagtaattcttgtaagattcaaagccccattaagctgatattcaaataatacttgattgaactatgtagatgatttatataagatcttaaacctaa |
29740499 |
T |
 |
| Q |
176 |
caaaaaccactgttaagcaaatt |
198 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
29740498 |
caaaaaccactgttaagcaaatt |
29740476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 29740905 - 29740850
Alignment:
| Q |
1 |
tcaattggatgagtgaaagaggcatttcatcgaacacattgtaagcaagagaaatt |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29740905 |
tcaattggatgagtgaaagaggcatttcatcgaacacattgtaagcaagagaaatt |
29740850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University