View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3115_high_39 (Length: 237)
Name: NF3115_high_39
Description: NF3115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3115_high_39 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 39591823 - 39592045
Alignment:
| Q |
1 |
ccaactggcttgcaaggtatggaataaaaataaatgcaagcagtaaggtaag---tgatattcttctgaccattatggtaaacgaacaaaggagaagttg |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39591823 |
ccaactggcttgcaaggtatggaataaaaataaatgcaagcagtaaggtaaggtgtgatattcttctgaccattatggtaaacgaacaaaggagaagttg |
39591922 |
T |
|
| Q |
98 |
aactcgaagcaagatgaaacaaagtaagttatgctgctagtttggcactagacagtacaaaaataggatggtaaagttaggaatgaccttgtagagttct |
197 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39591923 |
aacttgaagcaagatgaaacaaagtaagttatgctgctagtttggcacttgacagtacaaaaataggttggtaaagttaggaatgaccttgtagagttct |
39592022 |
T |
|
| Q |
198 |
ttatagtagagttagataactgt |
220 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
39592023 |
ttatagtagagttagataactgt |
39592045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University