View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3115_low_31 (Length: 289)
Name: NF3115_low_31
Description: NF3115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3115_low_31 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 105 - 289
Target Start/End: Original strand, 33554983 - 33555167
Alignment:
| Q |
105 |
gtaccttgtaaaagtctacagcaatgtagttaggccatcggttaccagcatctttatagcaagtatgcatctttcgaatcaatggggatgagttatccct |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
33554983 |
gtaccttgtaaaagtctacagcaatgtagttaggccatcggttaccagcatctttatagcaagtatgcatctttcgaatcaatggggatgagttatcctt |
33555082 |
T |
 |
| Q |
205 |
acatgcttcattggaatttaggacatttctgtaatagttcattaggactagtgattttgttattgtgttcattggatatgattct |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33555083 |
acatgcttcattggaatttaggacatttctgtaatagttcattaggactagtgattttgttgttgtgttcattggatatgattct |
33555167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University