View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3115_low_36 (Length: 253)
Name: NF3115_low_36
Description: NF3115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3115_low_36 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 16 - 253
Target Start/End: Original strand, 39591204 - 39591441
Alignment:
| Q |
16 |
gagaggagtatcacaaacctaatcagttaccctcctactaacagcctattttagcttcttggggaaatatttcacatataacttctatcatagaagttct |
115 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39591204 |
gagaggagcatcacaaacctaatcagttacactcctactaacagcctattttagcttcttggggaaatatttcacatataacttctatcatagaagttct |
39591303 |
T |
 |
| Q |
116 |
atggatcagaaatgcttcctagacctgtagtggcaagtttactgacaagagctagagcgttactggttatataataggctttgagaaccctattttgcag |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39591304 |
atggatcagaaatgcttcctagacctgtagtggcaagtttactgacaagagctagagcgttactggttatataataggctttgagaaccctattttgcag |
39591403 |
T |
 |
| Q |
216 |
caattgaattttcctaccgttttcgccttgaaacccat |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39591404 |
caattgaattttcctaccgttttcgccttgaaacccat |
39591441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University