View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3115_low_39 (Length: 238)
Name: NF3115_low_39
Description: NF3115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3115_low_39 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 76 - 215
Target Start/End: Original strand, 30422915 - 30423058
Alignment:
| Q |
76 |
gtgtgcgggttgaagagtgggaatcattcgttagatggtcaattaatttctttttaaatgatttttatgaggg----gagagtgtagaaaagttcaccat |
171 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
30422915 |
gtgtgccggttgaagagcgggaatcattcgttagatggtcaattaatttctttttaaatgatttttatgagggaagtgagagtgtagaaaagttcaccag |
30423014 |
T |
 |
| Q |
172 |
gtaaaattggatcaggtgtgacttgatcaggagaacggagattt |
215 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| | |||||| |
|
|
| T |
30423015 |
gtaaaattgaatcaggtgtgacttgatcaggagaatgaagattt |
30423058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University