View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3116_high_23 (Length: 320)
Name: NF3116_high_23
Description: NF3116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3116_high_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 19 - 276
Target Start/End: Original strand, 8880796 - 8881053
Alignment:
| Q |
19 |
tttaaggttgaaattgtctccacttataaacacatattcctatcaattgttcgacgtggaactctttaacaacatgcatcattaatgttattataaagct |
118 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
8880796 |
tttaagattgaaattgtctccacttataaacacatattcctatcaattgttcgacgtggaattctttaacaacatgcatcattaatattattataaagct |
8880895 |
T |
 |
| Q |
119 |
atagtaaatatgaatatttgttattatgaaatggaattgtagaaaatcgaggacactctgtaaaccttcttaactttgaaaacaacaggtgaatgaggca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8880896 |
atagtaaatatgaatatttgttattatgaaatggaattgtagaaaatcgaggacactctgtaaaccttcttaactttgaaaacaacaggtgaatgaggca |
8880995 |
T |
 |
| Q |
219 |
aagctaatcactcccatgcacacgtccctttctctctacgttcccccacctctgccgc |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8880996 |
aagctaatcactcccatgcacacgtccctttctctctacgttcccccacctctgccgc |
8881053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University