View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3116_high_32 (Length: 264)
Name: NF3116_high_32
Description: NF3116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3116_high_32 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 54 - 250
Target Start/End: Original strand, 5652050 - 5652246
Alignment:
| Q |
54 |
tatcaaatgttattgtagtcttttagatgtactttcggaacataatgttcttattatttaatgcaaaacaggagataaatatacatgaaatgcattccaa |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5652050 |
tatcaaatgttattgtagtcttttagatgtacttttggaacataatgttcttattattttatgcaaaacaggagataaatatacatgaaatgcattccaa |
5652149 |
T |
|
| Q |
154 |
taatataatttgtcatccacaaggaccacaacattccaacttgatatgaattaaatcacagaacaatccgtacgaatgttcccattgtgtgaattct |
250 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5652150 |
taagataatttgtcatccacaaggaccacaacattccaatttgatatgaattaaatcacagaacaatccgtacgaatgttcccattgtgtgaattct |
5652246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University