View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3116_high_61 (Length: 210)
Name: NF3116_high_61
Description: NF3116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3116_high_61 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 16 - 197
Target Start/End: Original strand, 7095748 - 7095929
Alignment:
| Q |
16 |
caaatatgtggcatatttcacctttgattcttcaggacagttaatcactttcaaaatcttctccacttcttgtagccacaaatcagccttctctgggtct |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
7095748 |
caaatatgtggcatatttcacctttgattcttcaggacagttaatcactttcaaaatcttctccacttcttgtagccacaaatcagccctctctgggtct |
7095847 |
T |
 |
| Q |
116 |
aattctccatggaattgaggtggattgtgacgacggaaatctgccaatccccttgaatctgcttccctatcttctctctgct |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7095848 |
aattctccatggaattgaggtggattgtgacgacggaaatctgccaatccccttgaatctgcttccctatcttctctctgct |
7095929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 16 - 197
Target Start/End: Complemental strand, 8376054 - 8375873
Alignment:
| Q |
16 |
caaatatgtggcatatttcacctttgattcttcaggacagttaatcactttcaaaatcttctccacttcttgtagccacaaatcagccttctctgggtct |
115 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8376054 |
caaatgtgtggcatatttcacctttgattcttcaggacagttaatcactttcaaaatcttctccacttcttgtagccacaaatcagccttctctgggtct |
8375955 |
T |
 |
| Q |
116 |
aattctccatggaattgaggtggattgtgacgacggaaatctgccaatccccttgaatctgcttccctatcttctctctgct |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8375954 |
aattctccatggaattgaggtggattgtgacgacggaaatctgccaatccccttgaatctgcttccctatcttctctctgct |
8375873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 117; Significance: 9e-60; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 23 - 195
Target Start/End: Complemental strand, 15420644 - 15420472
Alignment:
| Q |
23 |
gtggcatatttcacctttgattcttcaggacagttaatcactttcaaaatcttctccacttcttgtagccacaaatcagccttctctgggtctaattctc |
122 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||||| ||||||||||| || ||||||||||||||||||||||||||||||||||| | ||| | |
|
|
| T |
15420644 |
gtggcatatttcaccttagaatcttcaggacagttaatcacattcaaaatcttttcaacttcttgtagccacaaatcagccttctctgggtccacttccc |
15420545 |
T |
 |
| Q |
123 |
catggaattgaggtggattgtgacgacggaaatctgccaatccccttgaatctgcttccctatcttctctctg |
195 |
Q |
| |
|
| |||||||| ||||||||||||||||| ||||| ||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
15420544 |
cgtggaattggggtggattgtgacgacgaaaatcagccaagccccttgaatctgctgccctatcttctctctg |
15420472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University