View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3116_low_31 (Length: 296)
Name: NF3116_low_31
Description: NF3116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3116_low_31 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 144; Significance: 9e-76; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 144; E-Value: 9e-76
Query Start/End: Original strand, 146 - 293
Target Start/End: Original strand, 33823313 - 33823460
Alignment:
| Q |
146 |
tcatggaagattcattattggctttattatatgcattcttgatatcccctaattctatataattctttgggaacaaactagtaccaaactgccaataaag |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33823313 |
tcatggaagattcattattggctttattatatgcattcatgatatcccctaattctatataattctttgggaacaaactagtaccaaactgccaataaag |
33823412 |
T |
|
| Q |
246 |
ctagcaaattgaattctcaaaggcaagtgtcatagtagagttctacac |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33823413 |
ctagcaaattgaattctcaaaggcaagtgtcatagtagagttctacac |
33823460 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 13 - 72
Target Start/End: Original strand, 33823180 - 33823239
Alignment:
| Q |
13 |
aaatattacattaaaaacatacttggaaaattaatgtaaaatataattacaccgtctctt |
72 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
33823180 |
aaatattacattaaaaacatacttggaaaattattgtaaaatataattacaccgtctctt |
33823239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University