View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3116_low_32 (Length: 293)
Name: NF3116_low_32
Description: NF3116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3116_low_32 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 19 - 285
Target Start/End: Complemental strand, 7736848 - 7736582
Alignment:
| Q |
19 |
agcatcttggtatgaattgtgatattgtcatttgagcctgtcagatttgaaccaatcatctctaatcttattattttccatttgttctgtgttttttctt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
7736848 |
agcatcttggtatgaattgtgatattgtcatttgagcctgtcagatttgaaccaatcatctctaatcttattattttccatttgttctccgttttttctt |
7736749 |
T |
|
| Q |
119 |
tagatgttgctgaatataatgtacttaatatggaaaaaagcaagattcagagttttgttgaaaacttcccgcgttatcaaaaatatttgccctcttcaat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
7736748 |
tagatgttgctgaatataatgtacttaatatggaaaaaagcaagattcagagttttgttgaaaacttcccgcgttatcaaaaatattttccctcttcaat |
7736649 |
T |
|
| Q |
219 |
tcgtgcttggaggtgtgtacnnnnnnncctttgccataaataacttctttcttaaattgcctttgct |
285 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7736648 |
tcgtgcttggaggtgtgtactttttttcctttgccataaataacttctttcttaaattgcctttgct |
7736582 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University