View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3116_low_33 (Length: 291)
Name: NF3116_low_33
Description: NF3116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3116_low_33 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 138; Significance: 4e-72; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 98 - 278
Target Start/End: Complemental strand, 7944002 - 7943832
Alignment:
| Q |
98 |
atagtataaaaaatagatacaattatttttaataaaatcttataagaaagatatctagaatatagtatagcataccttaccttaccttaccttaccccag |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
7944002 |
atagtataaaaaatagatacaattatttttaataaaatcttataacaaagatatctggaatatagtatagcataccttaccttacc----------ccag |
7943913 |
T |
 |
| Q |
198 |
tttaatggaatggtgatggttacatctaaaatccaaacatatccaaatcctccctccagccaaactccatcttcagcccct |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7943912 |
tttaatggaatggtgatggttacatctaaaatccaaacatatccaaatcctccctccagccaaactccatcttcagcccct |
7943832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 18 - 95
Target Start/End: Complemental strand, 7945409 - 7945332
Alignment:
| Q |
18 |
agttgacattgagcagaatcccttcgatagaatcaagacgtcaaagtaaaattgaagagatatcaatgccaacgtgga |
95 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
7945409 |
agttgagattgagcagaatcccttcgatagaatcaagacgtcaaagtaatattgaagagatatcaatgccaacgtgga |
7945332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University