View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3116_low_40 (Length: 257)
Name: NF3116_low_40
Description: NF3116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3116_low_40 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 12 - 249
Target Start/End: Original strand, 21839067 - 21839303
Alignment:
| Q |
12 |
gtagcattaaccagcagctagctaatgggggcttctctagaacaaaactgagattcaatgtaagtatgttaagaaaaatacaaaagaatcgagtttcgaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||| ||||||||||| |
|
|
| T |
21839067 |
gtagcattaaccagcagctagctaatgggg-cttctctagaacaaaactgagattcaatgtaagtaggttaagaaaaatataaaagaaccgagtttcgaa |
21839165 |
T |
 |
| Q |
112 |
ctatggtcgagttgactcgatttattgtcggtcctagatgaaatcctttgttatttaaactttataatcgtaaaactacaattttagcctaacatcctca |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21839166 |
ctatggtcgagttgactcgatttattgtcggtcctagatgaaatcctttgttatttcaactttataatcgtaaaactacaattttagcctaacatcctca |
21839265 |
T |
 |
| Q |
212 |
cacacagcagcattctcactctatctcctcttcatctc |
249 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
21839266 |
cacacagcagcatcctcactctatctcctcttcttctc |
21839303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University