View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3116_low_45 (Length: 250)
Name: NF3116_low_45
Description: NF3116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3116_low_45 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 12 - 250
Target Start/End: Complemental strand, 54221245 - 54221000
Alignment:
| Q |
12 |
acagagtggcaaaacaactttcataacaacgcttaaggcacttgtcctaagtgtatgtttcaatagatttgctagatg-------caggatcaacaatga |
104 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
54221245 |
acagagtggcaaaacaactttcatgacaacgcttaaggcacttgtcctaagtgtatgtttcaatagatttgctagatggggacatcaggatcaacaatga |
54221146 |
T |
 |
| Q |
105 |
aaagcagaatttaaggaagttaaattagaatctatgttggaagacatgagatgacgagaacagatctttaccggaatctcattcattcccttttttccat |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54221145 |
aaagcagaatttaaggaagttaaattagaatctatgttgaaagacatgagatgacaagaacagatctttaccggaatctcattcattcccttttttccat |
54221046 |
T |
 |
| Q |
205 |
accctttttcaggaggaacaatcacagttcgctgcaaccatcattc |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54221045 |
accctttttcaggaggaacaatcacagttcgctgcaaccatcattc |
54221000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University