View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3116_low_56 (Length: 237)
Name: NF3116_low_56
Description: NF3116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3116_low_56 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 102; Significance: 9e-51; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 1 - 196
Target Start/End: Original strand, 8524453 - 8524650
Alignment:
| Q |
1 |
acaccagaaatgtaaggagatctcaatcttagatc-aactgaatccagaaaaaccaatctagactagatgtttataggggttacagagacggaccaacta |
99 |
Q |
| |
|
|||| ||||||||||||||| ||||||||| |||| ||| | |||||||||||||||| || |||||||||||||||||||||||||||||||||||| | |
|
|
| T |
8524453 |
acactagaaatgtaaggagaactcaatctttgatcgaaccggatccagaaaaaccaatgtaaactagatgtttataggggttacagagacggaccaacca |
8524552 |
T |
 |
| Q |
100 |
gagctcatatctcaatggga-ctaccccgataggttagaaccaccgcgacgacaaagacaacggaaaagggaccccaaagggttcacgacccatgttg |
196 |
Q |
| |
|
||||||||||||| |||||| | || || ||||| ||||| ||||||||| |||| ||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
8524553 |
gagctcatatctccatgggatcgactgcggtaggtgagaacaaccgcgacggaaaaggcaacggaaaggggaccccaaagggttcacgaccgatgttg |
8524650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 135 - 195
Target Start/End: Original strand, 29832278 - 29832338
Alignment:
| Q |
135 |
agaaccaccgcgacgacaaagacaacggaaaagggaccccaaagggttcacgacccatgtt |
195 |
Q |
| |
|
||||| |||||| || |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
29832278 |
agaacaaccgcggcggcaaagacaacggaaaagggaccccaaagggttcacgactcatgtt |
29832338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University