View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3116_low_61 (Length: 226)
Name: NF3116_low_61
Description: NF3116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3116_low_61 |
 | |
|
| [»] chr1 (4 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 30112183 - 30112404
Alignment:
| Q |
1 |
tttggcaggcaattagatatatttccatgctttgcccaatctcttttcttatttatttttgttgtcttgcaacataaatgtaaatcacataggatgaagc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30112183 |
tttggcaggcaattagatatatttccatgctttgcccaatctcttttcttatttatttt-gttgtcttgcaacataaatgtaaatcacataggatgaagc |
30112281 |
T |
|
| Q |
101 |
tgacctcaccttaagttgcagggtacatacacactcgacagtcgataaaaatatacaaaaattcatcatatgcttcatacattatctgatggtgacaata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
30112282 |
tgacctcaccttaagttgcagggtacatacacactcgacagtcgataaaaatatacaaaaat---tcatatgcttcatacattatctgatggtgacaata |
30112378 |
T |
|
| Q |
201 |
gggattggtctcattaccactagcat |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
30112379 |
gggattggtctcattaccactagcat |
30112404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 30152836 - 30153057
Alignment:
| Q |
1 |
tttggcaggcaattagatatatttccatgctttgcccaatctcttttcttatttatttttgttgtcttgcaacataaatgtaaatcacataggatgaagc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30152836 |
tttggcaggcaattagatatatttccatgctttgcccaatctcttttcttatttatttt-gttgtcttgcaacataaatgtaaatcacataggatgaagc |
30152934 |
T |
|
| Q |
101 |
tgacctcaccttaagttgcagggtacatacacactcgacagtcgataaaaatatacaaaaattcatcatatgcttcatacattatctgatggtgacaata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
30152935 |
tgacctcaccttaagttgcagggtacatacacactcgacagtcgataaaaatatacaaaaat---tcatatgcttcatacattatctgatggtgacaata |
30153031 |
T |
|
| Q |
201 |
gggattggtctcattaccactagcat |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
30153032 |
gggattggtctcattaccactagcat |
30153057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 17 - 109
Target Start/End: Original strand, 30150158 - 30150249
Alignment:
| Q |
17 |
atatatttccatgctttgcccaatctcttttcttatttatttttgttgtcttgcaacataaatgtaaatcacataggatgaagctgacctcac |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30150158 |
atatatttccatgctttgcccaatctcttttcttatttatttt-gttgtcttgcaacataaatgtaaatcacataggatgaagctgacctcac |
30150249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 188 - 226
Target Start/End: Original strand, 30150427 - 30150465
Alignment:
| Q |
188 |
gatggtgacaatagggattggtctcattaccactagcat |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
30150427 |
gatggtgacaatagggattggtctcattaccacaagcat |
30150465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University