View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3116_low_64 (Length: 222)
Name: NF3116_low_64
Description: NF3116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3116_low_64 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 20 - 206
Target Start/End: Original strand, 39371677 - 39371863
Alignment:
| Q |
20 |
agatgtgtgaatgagcttggaaatgagacaaaccctatatcagtattcagtcatgcaacaaatggtaaaggttattattttgctacattgtcacatgcaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39371677 |
agatgtgtgaatgagcttggaaatgagacaaaccctatatcagtattcagtcatgcaacaaatggtaaaggttattattttgctacattgtcacatgcaa |
39371776 |
T |
|
| Q |
120 |
agcttggatcaaaattgaagattaatgagtgcaaagcatacctagagagttctccattaaatatttgtaaagttcccaccaatgtga |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39371777 |
agcttggatcaaaattgaagattaatgagtgcaaagcatacctagagagttctccattaaatatttgtaaagttcccaccaatgtga |
39371863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 22 - 206
Target Start/End: Original strand, 39376265 - 39376449
Alignment:
| Q |
22 |
atgtgtgaatgagcttggaaatgagacaaaccctatatcagtattcagtcatgcaacaaatggtaaaggttattattttgctacattgtcacatgcaaag |
121 |
Q |
| |
|
||||||||||||||||||| |||||||| |||||| ||||||| ||||||| |||| || ||||||||||||| | || ||||||||||| |||| || |
|
|
| T |
39376265 |
atgtgtgaatgagcttggatatgagacaggtcctataacagtattgagtcatgtaacagatagtaaaggttattactatgttacattgtcacttgcagag |
39376364 |
T |
|
| Q |
122 |
cttggatcaaaattgaagattaatgagtgcaaagcatacctagagagttctccattaaatatttgtaaagttcccaccaatgtga |
206 |
Q |
| |
|
| |||||||| ||||||||||| || |||||||||||||||||||||||||||||| | | ||||||||||||||| |||||| |
|
|
| T |
39376365 |
ttgggatcaaagttgaagattaacgaatgcaaagcatacctagagagttctccattagagacatgtaaagttcccaccgatgtga |
39376449 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University