View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3116_low_69 (Length: 204)

Name: NF3116_low_69
Description: NF3116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3116_low_69
NF3116_low_69
[»] chr3 (1 HSPs)
chr3 (1-186)||(54220736-54220921)


Alignment Details
Target: chr3 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 1 - 186
Target Start/End: Original strand, 54220736 - 54220921
Alignment:
1 atactcttgaaagccatatgaattcaaggtgggagctccgcccggaaaggaaaggaagcgtgaatttgtcgacaacccaaatggtctattctctgcacaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54220736 atactcttgaaagccatatgaattcaaggtgggagctccgcccggaaaggaaaggaagcgtgaatttgtcgacaacccaaatggtctattctctgcacaa 54220835  T
101 gcagcaccaaaacctccacaagccatgtacacaatagttgaaggaatgcgagtgggtggaaaggtgatcgaaacacccctcttgat 186  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
54220836 gcagcaccaaaacctccacaagccatgtacacaatagttgaaggaatgcgagtgggtggaaaggtgatcgaaacaccccttttgat 54220921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University