View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3116_low_71 (Length: 202)
Name: NF3116_low_71
Description: NF3116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3116_low_71 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 7e-88; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 7e-88
Query Start/End: Original strand, 4 - 187
Target Start/End: Original strand, 49871941 - 49872124
Alignment:
| Q |
4 |
gatggacatcatcaactgcataaccaaggacttctttgcaaatatccatagcttgctttgtcatgtcattggtagccaattccttgtagagtgttgagtt |
103 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49871941 |
gatgaacatcatcaactgcataaccaaggacttctttgcaaatatccatagcttgctttgtcatgtcattggtagccaattccttgtagagtgttgagtt |
49872040 |
T |
|
| Q |
104 |
gtggatttgtttcgagagttcttcagctgttgcattgaatgcttgtttgatcaattccttcatgtctttgttgcctgtttttgc |
187 |
Q |
| |
|
||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
49872041 |
gtgtatttgtttcacgagttcttcagctgttgcattgaatgcttgtttgatcaattccttcatgtctttgtttcctgtttttgc |
49872124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 4 - 187
Target Start/End: Original strand, 49866010 - 49866193
Alignment:
| Q |
4 |
gatggacatcatcaactgcataaccaaggacttctttgcaaatatccatagcttgctttgtcatgtcattggtagccaattccttgtagagtgttgagtt |
103 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
49866010 |
gatgaacatcatcaactgcataaccaaggacttctttgcaaatatccatagcttgctttgtcatgtcattggtagctaattccttgtagagttttgagtt |
49866109 |
T |
|
| Q |
104 |
gtggatttgtttcgagagttcttcagctgttgcattgaatgcttgtttgatcaattccttcatgtctttgttgcctgtttttgc |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| || |||||||||||||||||||||| | || ||||||||||| |
|
|
| T |
49866110 |
atggatttgtttcgagagttcttcagctgttgctttgaatactgctttgatcaattccttcatgtctgtttttcctgtttttgc |
49866193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University