View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3117_high_45 (Length: 275)
Name: NF3117_high_45
Description: NF3117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3117_high_45 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 19 - 257
Target Start/End: Complemental strand, 46893705 - 46893467
Alignment:
| Q |
19 |
cttagtgttgagtttgtgatggataggcctgatgttgtttggagaatctctggtgaaaacttgatggtgcagccacgaaatggggtttcttgtttggcat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46893705 |
cttagtgttgagtttgtgatggataggcctgatgttgtttggagaatctctggtgaaaacttgatggtgcagccacgaaatggggtttcttgtttggcat |
46893606 |
T |
 |
| Q |
119 |
ttgtgaatggtgggttgcatcctaaagctgctattactattggaagtcgtcaattggaagaaaatatgatgatgtttgatcttgcaaggtcaaggcttgg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46893605 |
ttgtgaatggtgggttgcatcctaaagctgctattactattggaagtcgtcaattggaagaaaatatgatgatgtttgatcttgcaaggtcaaggcttgg |
46893506 |
T |
 |
| Q |
219 |
gtttactaattccttgaactcccatggaatgaagtgttc |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46893505 |
gtttactaattccttgaactcccatggaatgaagtgttc |
46893467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 60 - 145
Target Start/End: Complemental strand, 3063874 - 3063789
Alignment:
| Q |
60 |
gagaatctctggtgaaaacttgatggtgcagccacgaaatggggtttcttgtttggcatttgtgaatggtgggttgcatcctaaag |
145 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |||| | |||||||||||| ||| ||| ||||| ||||| || |||||| |
|
|
| T |
3063874 |
gagaatctatggtgaaaacttgatggtgcagccatataatgagatttcttgtttgggattcgtggatggttggttgtattctaaag |
3063789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University