View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3117_high_59 (Length: 246)
Name: NF3117_high_59
Description: NF3117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3117_high_59 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 107; Significance: 9e-54; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 109 - 231
Target Start/End: Complemental strand, 3925545 - 3925423
Alignment:
| Q |
109 |
gctccatttgcatatggtccaagcttcaatttatgatttatatacaaacatgagtaaacgatcatagatctgaagactatgagctcacatgaaaatagaa |
208 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
3925545 |
gctctatttgcatatggtccaagcttcaatttaagatttatatacaaacatgagtaaacgatcatagatctgaagactatgagctcatatgaaaatagaa |
3925446 |
T |
 |
| Q |
209 |
ttatatatttaaaatttgaaaat |
231 |
Q |
| |
|
||||| ||||||||||||||||| |
|
|
| T |
3925445 |
ttatagatttaaaatttgaaaat |
3925423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University