View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3117_high_63 (Length: 240)
Name: NF3117_high_63
Description: NF3117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3117_high_63 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 42610188 - 42609967
Alignment:
| Q |
1 |
ttatggaacatattttagatggaagttattatggtaaggctgcacaaaaagtacatgagattaatccacttcagaagcccaaacaagatagatacgcgat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42610188 |
ttatggaacatattttagatggaagttattatggtaaggctgcacaaaaagtacatgagattaatccacttcagaagcccaaacaagatagatacgcgat |
42610089 |
T |
 |
| Q |
101 |
tcgaacatcaccgcagtggcttggaccgcagattgaagtgattcgatacgcaacaaagatgattgagagggagataaattccgtgaatgacaatccactt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42610088 |
tcgaacatcaccgcagtggcttggaccgcagattgaagtgattcgatacgcaacaaagatgattgagagggagataaattccgtgaatgacaatccactt |
42609989 |
T |
 |
| Q |
201 |
attgatgtttcaagggataagg |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
42609988 |
attgatgtttcaagggataagg |
42609967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 161 - 222
Target Start/End: Original strand, 43216524 - 43216585
Alignment:
| Q |
161 |
gattgagagggagataaattccgtgaatgacaatccacttattgatgtttcaagggataagg |
222 |
Q |
| |
|
|||||| |||||||||||||| ||||| |||||||| || |||||||| ||| |||||||| |
|
|
| T |
43216524 |
gattgaaagggagataaattcagtgaacgacaatcctctgattgatgtggcaacggataagg |
43216585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University